| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.075312 |
| Chromosome: | plastome |
| Location: | 119832 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802312 | psaB,ChreCp048,2717038 | photosystem I P700 apoprotein A2; (1 of 1) K02690 - photosystem I P700 chlorophyll a apoprotein A2 (psaB) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCATCTGTTGGTACTATTACATCTTTAGTAGCACAACACATGTACTCAT |
| Internal bar code: | CCGGGATAGTTGGCCCTGTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 366 |
| LEAP-Seq percent confirming: | 3.44828 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACCACGAGCATCAAGAGCA |
| Suggested primer 2: | TGGTCAACACGTAGGTTGGG |