Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.075313 |
Chromosome: | chromosome 1 |
Location: | 1574165 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g008500 | (1 of 2) PF12796//PF13857 - Ankyrin repeats (3 copies) (Ank_2) // Ankyrin repeats (many copies) (Ank_5) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGGACATATGCGTGCGCCCTGCCGATCTTGCCAGCACGCCCTTGACTAC |
Internal bar code: | GATGTTCCAAAGAGCACAGTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1142 |
LEAP-Seq percent confirming: | 11.5385 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 23 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTTAGCATCCGTCCCCTCA |
Suggested primer 2: | AAACCGTCAATTGCAAGGCC |