Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.075317 |
Chromosome: | chromosome 12 |
Location: | 4476011 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g520400 | uL4m,MRPL4 | Mitochondrial ribosomal protein L4; (1 of 2) K02926 - large subunit ribosomal protein L4 (RP-L4, MRPL4, rplD) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGTTAGGATGAGCGGATCTGAGCCCGATGACTTGATACACAGACTGCGG |
Internal bar code: | TTGAGAAGAGCGCAACCCATCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2121 |
LEAP-Seq percent confirming: | 66.6667 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCAAGACCAAGGCAAGACA |
Suggested primer 2: | TCACAGTGTACCACGTGCTC |