| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.075318 |
| Chromosome: | chromosome 12 |
| Location: | 8475661 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g549700 | (1 of 1) K11884 - RNA-binding protein PNO1 (PNO1, DIM2) | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAACCGACTGCGTTGAGTGTGGGTGGGTGCTTGAGGCGGGCACTGGGC |
| Internal bar code: | AACGGAGCTCCGTGCCGTGATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1110 |
| LEAP-Seq percent confirming: | 5.88235 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGCACCATGCATCTCTCTC |
| Suggested primer 2: | GGGCTCCTTCCAGAACATCC |