Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.075335 |
Chromosome: | chromosome 11 |
Location: | 1876902 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467792 | (1 of 752) IPR027417 - P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGCCAGCGCACAAACGAGTGTTGGGATGAACTTGTACCGCCAATCAGG |
Internal bar code: | CTACGGCGCGATTTCGTATGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 275 |
LEAP-Seq percent confirming: | 25.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACACACTCCTTCCCAGGTC |
Suggested primer 2: | TGGGAACAGGTTGTGGCTTT |