Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.075388 |
Chromosome: | chromosome 1 |
Location: | 3663428 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g023787 | ARB2 | Soluble ABC-F domain containing protein, propably cytosolic; (1 of 2) K06185 - ATP-binding cassette, subfamily F, member 2 (ABCF2) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCCTCCGTCATCTCCAGGGCCGCCAGCGCCTCAGCCTCCACCTCCAGC |
Internal bar code: | AACGCGAAAAGTGGGGTTCATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 205 |
LEAP-Seq percent confirming: | 92.3077 |
LEAP-Seq n confirming: | 12 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTACACACACGCACACACAC |
Suggested primer 2: | GTGTGCTGTTGTGGCTGATG |