| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.075402 |
| Chromosome: | chromosome 8 |
| Location: | 3838416 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g381550 | (1 of 10) PTHR31867//PTHR31867:SF1 - FAMILY NOT NAMED // EXPANSIN-A1-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCCACCTCCACGCGCACGCCCTGCCTGGCCCCCTCCGCCCTCTCTGCC |
| Internal bar code: | CGCCGTCTTTTAAGATAGCTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 617 |
| LEAP-Seq percent confirming: | 23.5294 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGAGGGTGAAGGTGTGAGG |
| Suggested primer 2: | TACTACCCCGCCAACCAGTA |