| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.075417 |
| Chromosome: | chromosome 8 |
| Location: | 4041355 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g382716 | (1 of 5) IPR000626//IPR019956//IPR029071 - Ubiquitin domain // Ubiquitin // Ubiquitin-related domain | CDS | |
| Cre08.g382750 | (1 of 7) IPR000104//IPR020683 - Antifreeze protein, type I // Ankyrin repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCAGGTCGTACACGTCCAGGTCGGAGTGCACGTCCTGCAGCGTGATGGT |
| Internal bar code: | GTACCAACAATCAAGAGGCAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1564 |
| LEAP-Seq percent confirming: | 35.4839 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGACAGTCTCCCGTTTCACA |
| Suggested primer 2: | CACACAGCACCTCAAGTTGC |