Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.075420 |
Chromosome: | chromosome 10 |
Location: | 4528205 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g451300 | EXN13 | (1 of 3) PTHR13620//PTHR13620:SF0 - 3-5 EXONUCLEASE // EXONUCLEASE 3'-5' DOMAIN-CONTAINING PROTEIN 2; 3'-5' exonuclease | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGCAACATTACCAGAACATTATGCGGCCACCCCCGGCCTTCGGATCCC |
Internal bar code: | ATGGCGGCTTTCGGTTTATGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 743 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCAACAGTGATTTGGCAGC |
Suggested primer 2: | CTCGAGGCATGAACACCCTT |