| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.075458 |
| Chromosome: | chromosome 16 |
| Location: | 2365117 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g659300 | CYB2,CYB5-2 | (1 of 2) PTHR19359//PTHR19359:SF29 - CYTOCHROME B5 // SUBFAMILY NOT NAMED; Cytochrome b5 flavohemoprotein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCGGCAGGGGTGCCCCGGGCTCGAGGAGGCCGATAAAGTAGCGGTCTA |
| Internal bar code: | AGGCAGAGGCTGGTGAATAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1981 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTTCAACAGCACGCGTCTA |
| Suggested primer 2: | CACAACCGTTGCAATCCCTG |