Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.075567 |
Chromosome: | chromosome 6 |
Location: | 3141248 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g275650 | RPN3 | (1 of 1) K03033 - 26S proteasome regulatory subunit N3 (PSMD3, RPN3); 26S proteasome regulatory subunit | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCAGCCGCTCAGCGGCAGTTGCTGGATCGGTGCTTCGAGCAATGCGGT |
Internal bar code: | GTGGAACATCGGTGTGCCCGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 713 |
LEAP-Seq percent confirming: | 83.3333 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACTCGGTCAGCTCCACTTG |
Suggested primer 2: | AGGACGAGGACGACTTCTGA |