| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.075571 |
| Chromosome: | chromosome 16 |
| Location: | 4590441 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g671050 | (1 of 110) 3.4.19.12 - Ubiquitinyl hydrolase 1 / Ubiquitin thiolesterase | 3'UTR | |
| Cre16.g671100 | (1 of 1) K12177 - COP9 signalosome complex subunit 3 (COPS3, CSN3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTGAAGCGTGTGCGACCGTGGCCACCCGAGTGTGGCTTGCGTGCACTC |
| Internal bar code: | CATCGTAGTCCAACGCTGACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 750 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTGGGTGACTGGGTGATG |
| Suggested primer 2: | CGATCCAAGTACGACCTGGG |