| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.075590 |
| Chromosome: | chromosome 13 |
| Location: | 1570841 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g573050 | (1 of 1) K14769 - U3 small nucleolar RNA-associated protein 11 (UTP11) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCCCTCCGTCAGCTCACCTGAATCGCACACCACACTGTCGCCAAATCC |
| Internal bar code: | TAGTTTCGCCCTAACCATTGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 669 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGCTTTCTCTGCCACAAAA |
| Suggested primer 2: | GCGCGAAATAGGGACGAAAC |