| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.075608 |
| Chromosome: | chromosome 2 |
| Location: | 3651948 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g099950 | (1 of 6) 3.4.19.12//3.4.22.69 - Ubiquitinyl hydrolase 1 / Ubiquitin thiolesterase // SARS coronavirus main proteinase / Severe acute respiratory syndrome coronavirus main protease | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGAAGGCGACCCAGACACGAAGAGCCCGGCAGCAGGTGTGTGGTGTCTC |
| Internal bar code: | CAAACATGTAGACTGAGTTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1215 |
| LEAP-Seq percent confirming: | 84.6154 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTTAGGAAACACCAGGGA |
| Suggested primer 2: | GCTGTAACGAGCATGCCATG |