| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.075679 |
| Chromosome: | chromosome 10 |
| Location: | 6257143 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g463350 | HRP3 | Hydroxyproline-rich glycoprotein; (1 of 1) 2.7.1.107//2.7.11.18//3.2.1.4 - Diacylglycerol kinase (ATP) / Diglyceride kinase // [Myosin light-chain] kinase / Smooth-muscle-myosin-light-chain kinase // Cellulase / Endoglucanase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGTTTCCCCCACCCCTTCGCCTGCGGGCACCGCCCCCAAGCCCGCCCC |
| Internal bar code: | AGGGGATTGCCCCACTATTCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 79 |
| LEAP-Seq percent confirming: | 5.55556 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCAGATGCGTGTTTGTGG |
| Suggested primer 2: | CATCTACTCGCGCGTGTTTG |