| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.075718 |
| Chromosome: | chromosome 13 |
| Location: | 3345077 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g586400 | (1 of 1) 1.14.11.23//1.14.11.9 - Flavonol synthase / FLS // Flavanone 3-dioxygenase / Naringenin,2-oxoglutarate:oxygen oxidoreductase (3-hydroxylating) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCAGAAGTGGTGGAGTGTAGACATGCTACAGCGGCTAGCCCTAGGAGTG |
| Internal bar code: | AATATGGCAAGTGTATCCATAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1483 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGGTCTGGCACTTTGTTT |
| Suggested primer 2: | AAGCATTCTTGGCCACGGTA |