| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.075775 |
| Chromosome: | chromosome 12 |
| Location: | 7347197 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g557950 | DNJ27 | (1 of 1) K09528 - DnaJ homolog subfamily C member 8 (DNAJC8); DnaJ-like protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGCCCAACCGCCGGGGCTCTACCATACTCACGCATACCCCCAATCACA |
| Internal bar code: | AGAAGCACCCTGGCGGTTTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 144 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCCGCGACTTCATTTTCCA |
| Suggested primer 2: | AACCTGCATTTTGACGCCAC |