| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.075784 |
| Chromosome: | chromosome 9 |
| Location: | 4622058 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g401663 | (1 of 1) K14795 - ribosomal RNA-processing protein 36 (RRP36) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAGGGTGCCTTATGCCAAGTCCCAGCGACTGGTCAGCATCAAACACCCA |
| Internal bar code: | ATGGACCCCTGTGTTTTTCTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 183 |
| LEAP-Seq percent confirming: | 71.4286 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGGTTGGGCGATATCATG |
| Suggested primer 2: | CTCGTCACAACCTTTCCCGA |