| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.075790 |
| Chromosome: | chromosome 6 |
| Location: | 8294951 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g307012 | (1 of 5) PF13391 - HNH endonuclease (HNH_2) | 3'UTR | |
| Cre06.g307075 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGGGCCGGCTGGCCAAGAAGCTGCACATGGATGCTGATCATGTACATG |
| Internal bar code: | TTTTTGTCACAAACGAGGTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 391 |
| LEAP-Seq percent confirming: | 37.5 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTGCACCTCCTTACCCAC |
| Suggested primer 2: | GTCATCAGTTGGGAGCTGCT |