| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.075795 |
| Chromosome: | chromosome 1 |
| Location: | 1711117 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g009450 | DNJ22 | DnaJ-like protein; (1 of 5) IPR000104//IPR001623 - Antifreeze protein, type I // DnaJ domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGGAAGGGCGTGTTTCTTGGTGCAATTGCAGGTTGTGGCGACAACAAT |
| Internal bar code: | CCTATTTTCTAATAGTGCGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 538 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTTGTTCGCACATGCAGG |
| Suggested primer 2: | TGTCGTCATCTCGCATACCG |