| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.075806 |
| Chromosome: | chromosome 1 |
| Location: | 1375716 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g007150 | (1 of 1) PTHR12864:SF14 - RAN-BINDING PROTEINS 9/10 HOMOLOG | 3'UTR | |
| Cre01.g007200 | (1 of 1) K16675 - palmitoyltransferase ZDHHC9/14/18 (ZDHHC9_14_18) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATAGCACAGTGTACATTCATATTATAGCTAGTGTCCGCGACGACTGGAC |
| Internal bar code: | AATCATTTTAGGCATATGTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 966 |
| LEAP-Seq percent confirming: | 40.0 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTTGCGGGTGGTTGTTTCG |
| Suggested primer 2: | AATGCACCTATTGGCCTGCT |