Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.075830 |
Chromosome: | plastome |
Location: | 82978 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802298 | ChreCp033,rpoA,2717004 | (1 of 1) PF03118 - Bacterial RNA polymerase, alpha chain C terminal domain (RNA_pol_A_CTD); RNA polymerase alpha subunit | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGATTTATATTTACAAAGTTCATTAAACGCTCCTATAGGTATTTTAAA |
Internal bar code: | AATTTCGGGGCTTAAGATTGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 128 |
LEAP-Seq percent confirming: | 20.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCCTTCGGGCAAGTAAACT |
Suggested primer 2: | ACGGTTGTTAGCATTCCACCA |