| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.075848 |
| Chromosome: | chromosome 6 |
| Location: | 2362212 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g268100 | HTB10 | (1 of 27) K11252 - histone H2B (H2B); Histone H2B | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCCCTGCTCCGTGTCAAGGTGGTGTTGAGAAACACCGAGTTTGTTGTA |
| Internal bar code: | TGCGAGTCTGCTTAAAAAGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 757 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCTTTGCCGCATCAACAAC |
| Suggested primer 2: | TGCATGCACCATACACCCAT |