| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.075882 |
| Chromosome: | plastome |
| Location: | 136312 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802320 | chlN,2716986,ChreCp056 | light-independent protochlorophyllide reductase subunit N; (1 of 1) K04038 - light-independent protochlorophyllide reductase subunit N (chlN) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACAAGAGTTTGGATTGAAAAAATTTGTGGTGCTTTTGGCATTAATCCT |
| Internal bar code: | CGGCATGGATCAAATAGTAATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 432 |
| LEAP-Seq percent confirming: | 38.4615 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCCTGCCAACTGCCTAAT |
| Suggested primer 2: | CCCATTGTTGTAGCACGTGC |