| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.075898 |
| Chromosome: | chromosome 1 |
| Location: | 3379599 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g021900 | PUS11 | (1 of 1) PTHR11142:SF10 - TRNA PSEUDOURIDINE SYNTHASE; RNA pseudouridine synthase | outside_mRNA |
| Cre01.g021950 | (1 of 1) PF08393//PF12777//PF12781 - Dynein heavy chain, N-terminal region 2 (DHC_N2) // Microtubule-binding stalk of dynein motor (MT) // ATP-binding dynein motor region D5 (AAA_9) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCGTCACTTCGTCCACCCAGCATCCTGTGCTGCCCGCAACCGTACCAT |
| Internal bar code: | AGCGTTGGGGAGGCGCACACAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1223 |
| LEAP-Seq percent confirming: | 50.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGCTGTGAGCTTCAGTGAC |
| Suggested primer 2: | CTTGGGCTCAGTGCTGATGA |