| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.075925 |
| Chromosome: | chromosome 7 |
| Location: | 3572591 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g336700 | (1 of 781) IPR000104 - Antifreeze protein, type I | 3'UTR | |
| Cre07.g800816 | (1 of 1) PTHR10073:SF7 - DNA MISMATCH REPAIR PROTEIN MLH3-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCGGCACGATCGGCCCATGTACACTACGCGCAGCCGTGCGGGGGCTAC |
| Internal bar code: | TTTGTCCGTTTTAAAGCCAAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 6153 |
| LEAP-Seq percent confirming: | 93.1034 |
| LEAP-Seq n confirming: | 27 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCTGTCCTTCTTGCCTGG |
| Suggested primer 2: | AACACAGGAAACATGCGTGC |