Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.075926 |
Chromosome: | chromosome 14 |
Location: | 2697530 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g625802 | (1 of 1) K10696 - E3 ubiquitin-protein ligase BRE1 [EC:6.3.2.19] (BRE1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAGCCGCTCCGCCACCACCGCGTTTGTGGCCTCGTCCTTGTCCGCCAG |
Internal bar code: | AAGACACTGGAAGTCCGGTGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 300 |
LEAP-Seq percent confirming: | 11.7647 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCCGTGCCAACTGACAATA |
Suggested primer 2: | TGATTGTGGGATGGAGTGGC |