Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.075999 |
Chromosome: | chromosome 12 |
Location: | 7771480 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g554200 | VTI4,MEMB1 | (1 of 1) K08496 - golgi SNAP receptor complex member 2 (GOSR2, BOS1); ER-Golgi Qb-SNARE, Memb/GS35/Bos1-family (Qb.II) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCGCCCCGCGCTCTGCCATGCCACCCGGGGCCCCGGCGGACAACGGC |
Internal bar code: | TAGATTCGATTCTTTCGCCCGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 142 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACACTGCCACTGCTTTCAC |
Suggested primer 2: | GCGAGTGTCTGTGGAATCCA |