| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.075999 |
| Chromosome: | chromosome 12 |
| Location: | 7771480 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g554200 | VTI4,MEMB1 | (1 of 1) K08496 - golgi SNAP receptor complex member 2 (GOSR2, BOS1); ER-Golgi Qb-SNARE, Memb/GS35/Bos1-family (Qb.II) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCGCCCCGCGCTCTGCCATGCCACCCGGGGCCCCGGCGGACAACGGC |
| Internal bar code: | TAGATTCGATTCTTTCGCCCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 142 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACTGCCACTGCTTTCAC |
| Suggested primer 2: | GCGAGTGTCTGTGGAATCCA |