| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.076089 |
| Chromosome: | chromosome 1 |
| Location: | 5662950 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g040500 | (1 of 1) K10643 - CCR4-NOT transcription complex subunit 4 (CNOT4, NOT4, MOT2) | outside_mRNA | |
| Cre01.g800098 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCAAGCTCGCCTGCTACTCCTTGTGCTGTTTGGGCCGGGCGTTGGCTG |
| Internal bar code: | AGGAATATCCTTTCACATGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1262 |
| LEAP-Seq percent confirming: | 62.5 |
| LEAP-Seq n confirming: | 50 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 80 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAACAAGAGCCAGAGTCGC |
| Suggested primer 2: | CAAACATCTAGAAGCGCGCC |