Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.076111 |
Chromosome: | chromosome 15 |
Location: | 5564684 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre46.g761047 | (1 of 3) IPR000104//IPR027417 - Antifreeze protein, type I // P-loop containing nucleoside triphosphate hydrolase | outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCACCATGGGCTGGCGGGGGAAAAACCCCCGCTCCCCACTCCATGGTG |
Internal bar code: | GCAGCTTGTGACAAGCAGTCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1698 |
LEAP-Seq percent confirming: | 59.6154 |
LEAP-Seq n confirming: | 31 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTGAGAGCGTGTGGACACT |
Suggested primer 2: | CGAAGGAACATGTTAGCGCG |