| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.076116 |
| Chromosome: | chromosome 5 |
| Location: | 1006340 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g247250 | (1 of 781) IPR000104 - Antifreeze protein, type I | 5'UTR | |
| Cre05.g247300 | (1 of 1) PF13432//PF13489 - Tetratricopeptide repeat (TPR_16) // Methyltransferase domain (Methyltransf_23) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCGCGGGATCCCCGGATCGGCCCCGATATGGGCCGCGTGCCGATGGGC |
| Internal bar code: | TTGGAGCCAGTTTCCGTGAGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1472 |
| LEAP-Seq percent confirming: | 42.8571 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACTTCAGTCCGCAGTTCC |
| Suggested primer 2: | ATCCGGTACAATGGGGGAGA |