Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.076117 |
Chromosome: | plastome |
Location: | 87929 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802299 | rps2,ChreCp034,2717005 | 30S ribosomal protein S2; (1 of 1) PTHR12534:SF0 - 28S RIBOSOMAL PROTEIN S2, MITOCHONDRIAL | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGCCGCTTTTTAACATTTGACGCAGACTTGAACGTACAAATGCTTTTTT |
Internal bar code: | GCGGCCTATTACCCAGTGGGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 99 |
LEAP-Seq percent confirming: | 7.14286 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAGCATTAACACCAGGTGC |
Suggested primer 2: | ACTGCTTGCTTACCAGACGT |