Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.076132 |
Chromosome: | chromosome 16 |
Location: | 3744097 |
Confidence (%): | 40 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g683437 | (1 of 1) K16278 - E3 ubiquitin-protein ligase HOS1 [EC:6.3.2.19] (HOS1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGACTTCCTGCCGCTGTTCTTCCTGCAGCGCGGCCGCGTCAATGAGGCCA |
Internal bar code: | GGCCCCTCACTTATCCGCCCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2576 |
LEAP-Seq percent confirming: | 46.6667 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGACCCAGATTCATGCACCG |
Suggested primer 2: | CGCCTGTTCACTCACTACGA |