Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.076147 |
Chromosome: | chromosome 12 |
Location: | 2940755 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g502350 | HEL50 | (1 of 1) K10899 - ATP-dependent DNA helicase Q1 [EC:3.6.4.12] (RECQL); DEAD/DEAH box DNA/RNA helicase, related to RECQ1 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCCACGCTGCTGCAGCTGGTGGAGCTGTGGCGCAAGGAGCCGGGGCCGC |
Internal bar code: | GGGCGCAAGTTCTCGTGGACCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2640 |
LEAP-Seq percent confirming: | 87.5 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTACCCCATTCTGTTGGT |
Suggested primer 2: | CCCAACCTCACAGCCATGAT |