| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.076194 |
| Chromosome: | chromosome 13 |
| Location: | 1899806 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g575776 | (1 of 781) IPR000104 - Antifreeze protein, type I | 3'UTR | |
| Cre13.g575800 | IGS1 | Indole-3-glycerol-phosphate synthase; (1 of 2) 4.1.1.48 - Indole-3-glycerol-phosphate synthase / Indoleglycerol phosphate synthetase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACTTTATCTTGTGAACACTTGGTCACCCGAGATTTATAGACCCATACAC |
| Internal bar code: | GGAGGAGTATGGAACATCGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 329 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGGTGACTGATCGGTGTG |
| Suggested primer 2: | AGCGTTGTCGATAACCGTGT |