Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.076204 |
Chromosome: | chromosome 2 |
Location: | 7594323 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g386912 | DGTT2 | Diacylglycerol acyltransferase, DGAT Type 2; (1 of 4) K14457 - 2-acylglycerol O-acyltransferase 2 (MOGAT2, MGAT2) | 3'UTR |
Cre09.g386949 | (1 of 17) IPR015813 - Pyruvate/Phosphoenolpyruvate kinase-like domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTCATTCCTGACTTTCACACTTCCCTCTCAGACTGCGGCCGTCAGCAC |
Internal bar code: | CTTTTGCTCTTGGCTACAAATA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4389 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 35 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGTTTTGCCCCCAAACAAT |
Suggested primer 2: | CCCAGTCTCAATCCCCACAC |