| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.076236 |
| Chromosome: | chromosome 15 |
| Location: | 5293843 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g734564 | MDH1,MTHI1,OPR100 | (1 of 239) IPR016024 - Armadillo-type fold; Maturation/stability and Translation of the atpH and atpI mRNAs 1 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCTCAATAGCCCGACCGCGCTTTTGCACGCTGTTAAGCCTATAGCAGC |
| Internal bar code: | GTCTTAGTTGGACGATATCAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2519 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCAGTTGGACGCCACAATA |
| Suggested primer 2: | GCCCATGTCATCAACGATGC |