Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.076237 |
Chromosome: | plastome |
Location: | 30624 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802279 | rps8,2716952 | 30S ribosomal protein S8; (1 of 1) PTHR11758//PTHR11758:SF17 - 40S RIBOSOMAL PROTEIN S15A // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTTAGCAAAAAAATCAAGTGTTTCAATTCCATTTACACGCTTAAATCA |
Internal bar code: | CGCTATGGTGGGCAGTTTATAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 890 |
LEAP-Seq percent confirming: | 63.2911 |
LEAP-Seq n confirming: | 50 |
LEAP-Seq n nonconfirming: | 29 |
LEAP-Seq n unique pos: | 79 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACGTAGACGAGCTTCACGA |
Suggested primer 2: | TCTGGGTAAGTCCACTGCCT |