| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.076243 |
| Chromosome: | chromosome 1 |
| Location: | 3375495 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g021850 | HEL2 | (1 of 2) PTHR24031:SF249 - ATP-DEPENDENT DNA HELICASE RECG; DEAD/DEAH box helicase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATAGGAGCATCCCTTACATTGCGAGCGCGTTAGGGCGCCATGAGTGCA |
| Internal bar code: | CTTAAATGCACCCATAGGGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 168 |
| LEAP-Seq percent confirming: | 4.7619 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTACCAGCTTCGACGACC |
| Suggested primer 2: | GAGCGATGCGATGGATGTTG |