Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.076260 |
Chromosome: | chromosome 10 |
Location: | 4017571 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g447500 | KIN12-3,KIN16B,KIN16-2 | Kinesin motor protein; (1 of 1) K10392 - kinesin family member 1 (KIF1) | CDS |
Cre10.g447550 | (1 of 2) PF03200 - Glycosyl hydrolase family 63 C-terminal domain (Glyco_hydro_63) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTACTGAACTATTGCAACTAGACCGTTCGAATGGAGTCGTCTTGTCCA |
Internal bar code: | TGCTACCAATTGCGCTGTGTGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1722 |
LEAP-Seq percent confirming: | 38.8889 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTAGCCCTCCATCGTGTACG |
Suggested primer 2: | AGAACAGCAGTGCGATGTGA |