| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.076283 |
| Chromosome: | chromosome 12 |
| Location: | 7257062 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g558650 | EIF2B,EIF2BD | (1 of 1) K03680 - translation initiation factor eIF-2B subunit delta (EIF2B4); eIF-2B delta subunit | 5'UTR |
| Cre12.g558700 | FAP67 | Flagellar Associated Protein 67; (1 of 4) K00940 - nucleoside-diphosphate kinase (ndk, NME) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGAGGCATGATCATTGGATGAATTTGCACTATAAACGTCAACATTCAA |
| Internal bar code: | TGCTAGTAATGGTCTAAACTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1201 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATCCACGGACATAGCTGC |
| Suggested primer 2: | CCTCACGACCATAGCATCCC |