Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.076309 |
Chromosome: | plastome |
Location: | 20195 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802271 | ChreCp009,2717052,chlL | light-independent protochlorophyllide reductase iron-sulfer ATP-binding protein; (1 of 1) K04037 - light-independent protochlorophyllide reductase subunit L (chlL) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGATTATCATTATGAAGATATTTGGCCCGAAGATGTTATTTACGGAGG |
Internal bar code: | CAATCGATATTGCTTCGCTGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 103 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCGCTAAACGCAATGGATG |
Suggested primer 2: | CCTCCTTCCCCTTCCCCTT |