| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.076313 |
| Chromosome: | chromosome 2 |
| Location: | 3041177 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095600 | (1 of 781) IPR000104 - Antifreeze protein, type I | 5'UTR | |
| Cre02.g095650 | (1 of 5) 1.14.13.114 - 6-hydroxynicotinate 3-monooxygenase / HNA-3-monooxygenase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACAGATCGCAATTTCGGTGTTGCGTGTGTTCGCTACGAGCGTCTGGTTC |
| Internal bar code: | ACGGGGGCAAAGACAATAGAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 877 |
| LEAP-Seq percent confirming: | 84.375 |
| LEAP-Seq n confirming: | 27 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGAGGCTCTGGCACTTGAG |
| Suggested primer 2: | TCATCTCCACAAGCACACCC |