| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.076371 |
| Chromosome: | chromosome 2 |
| Location: | 4739303 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g108400 | DAD1 | Putative defender against death (DAD) protein; (1 of 1) K12668 - oligosaccharyltransferase complex subunit epsilon (OST2, DAD1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGTTGGTCGGGTGTCAGGCACAACCGATGAGCTGTGTACTCTGAAGCT |
| Internal bar code: | CTAATACTGAATAAAATCACGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4322 |
| LEAP-Seq percent confirming: | 98.6301 |
| LEAP-Seq n confirming: | 72 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 73 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTTCACTCAGCTGCCGTAC |
| Suggested primer 2: | AGCCAACAAGGAGTTCTCGG |