| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.076374 |
| Chromosome: | chromosome 16 |
| Location: | 4649582 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g667450 | TLP2 | (1 of 3) PF01167 - Tub family (Tub); Tubby-Like Protein 2 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTACGGCTTCGCCAGGTTGGCCTCGTGGTTGGAGGCAGCATCTTTGCTC |
| Internal bar code: | TCGTGAGTGGTTGAGCAAGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 5845 |
| LEAP-Seq percent confirming: | 72.0497 |
| LEAP-Seq n confirming: | 116 |
| LEAP-Seq n nonconfirming: | 45 |
| LEAP-Seq n unique pos: | 161 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTGTTGATTTGTGGCGTG |
| Suggested primer 2: | GACCTGACGTCACATGCTCA |