| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.076376 |
| Chromosome: | chromosome 9 |
| Location: | 4988472 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g405200 | MRPL13,uL13m | Mitochondrial ribosomal protein L13; (1 of 2) K02871 - large subunit ribosomal protein L13 (RP-L13, MRPL13, rplM) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAAACCTGCGGACCCGTCTTTTCTTGACTCTACAAATCTTACCGCTTCG |
| Internal bar code: | AGTCTGGTTGTTCAATTTCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3938 |
| LEAP-Seq percent confirming: | 98.5294 |
| LEAP-Seq n confirming: | 67 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 68 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGATTTGGGGTCAGCGAA |
| Suggested primer 2: | TGGGTTTAGACACGGACTGC |