Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.076407 |
Chromosome: | plastome |
Location: | 170289 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802326 | psaJ,2716958,ChreCp061 | photosystem I subunit IX; (1 of 1) K02697 - photosystem I subunit IX (psaJ) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGTGTGTCAGTCACATTTATTTACCCTCACGGTGAAATAAGCTATTTC |
Internal bar code: | GCTATAGTAAGTGATAGTGAAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1127 |
LEAP-Seq percent confirming: | 85.7143 |
LEAP-Seq n confirming: | 30 |
LEAP-Seq n nonconfirming: | 5 |
LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGCAGCTGTTTTTGACCCC |
Suggested primer 2: | TTTGCAACTTTAGCGGGTGC |