| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.076431 |
| Chromosome: | chromosome 9 |
| Location: | 5751827 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g410750 | NIR1,NII1 | Nitrite reductase, chloroplastic; (1 of 1) 1.7.7.1 - Ferredoxin--nitrite reductase | 5'UTR |
| Cre09.g801077 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGCGGGAGCGCGGATGGGGGGACCAAGGGAATCCCCCAAACCGAGTCC |
| Internal bar code: | AGGTGGTTTTGTATTTGGGTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 282 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGGCGATTATGAACCCTCG |
| Suggested primer 2: | CCAAGTGGTCACAAACGCTG |