| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.076456 |
| Chromosome: | chromosome 10 |
| Location: | 3321844 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g443300 | CNK5 | NimA-related protein kinase; (1 of 1) PTHR24361//PTHR24361:SF368 - MITOGEN-ACTIVATED KINASE KINASE KINASE // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTGGCGTACGGTACGTTTGTCCCAACCCACCCATCATGCCGTCCCGCC |
| Internal bar code: | AGAGCAATAAACGGATCGTCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 844 |
| LEAP-Seq percent confirming: | 58.8235 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTGTACCCACCGACTGAA |
| Suggested primer 2: | GTGGTCACGTATCTGCTGCT |