| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.076489 |
| Chromosome: | chromosome 1 |
| Location: | 1659709 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g009101 | (1 of 37) PF13639 - Ring finger domain (zf-RING_2) | 3'UTR | |
| Cre01.g009150 | (1 of 1) PF14329 - Domain of unknown function (DUF4386) (DUF4386) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATCAATATCTTCGCATTGGCAGTATCCGCTACACGGCCCCTCTTGCGGG |
| Internal bar code: | ATACGAAACGCTCACAAGTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1089 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTCAAGGTGCATGCAAAGC |
| Suggested primer 2: | TGAATGTTGTTGGCGCCTTG |